Last updated: 2022-10-09

Checks: 2 0

Knit directory: Bio322/

This reproducible R Markdown analysis was created with workflowr (version 1.7.0). The Checks tab describes the reproducibility checks that were applied when the results were created. The Past versions tab lists the development history.

R Markdown file: up-to-date

Great! Since the R Markdown file has been committed to the Git repository, you know the exact version of the code that produced these results.

Repository version: 0c8b7c6

Great! You are using Git for version control. Tracking code development and connecting the code version to the results is critical for reproducibility.

The results in this page were generated with repository version 0c8b7c6. See the Past versions tab to see a history of the changes made to the R Markdown and HTML files.

Note that you need to be careful to ensure that all relevant files for the analysis have been committed to Git prior to generating the results (you can use wflow_publish or wflow_git_commit). workflowr only checks the R Markdown file, but you know if there are other scripts or data files that it depends on. Below is the status of the Git repository when the results were generated: 


Ignored files:
    Ignored:    .DS_Store
    Ignored:    .RData
    Ignored:    .Rhistory
    Ignored:    .Rproj.user/
    Ignored:    analysis/.DS_Store

Untracked files:
    Untracked:  210922_genome expression_epigenetics.pptx
    Untracked:  210927.module1.2.RNAseq_on_Galaxy.pdf
    Untracked:  220317_Advanced topics in genomics.docx
    Untracked:  220317_Advanced topics in genomics_MarieSai.docx
    Untracked:  BIO322_Teaching plan BIO322 2021.docx
    Untracked:  Bio322.09132021.pdf
    Untracked:  Bio322.09132021.pptx
    Untracked:  Bio322.09152021.backup.pptx
    Untracked:  Bio322.09152021.pdf
    Untracked:  Bio322.09152021.pptx
    Untracked:  Bio322.09202021.pdf
    Untracked:  Bio322.09202021.pptx
    Untracked:  Bio322.09272021.pptx
    Untracked:  Bio322.09272021/
    Untracked:  Bio322scRNAseq.tsv
    Untracked:  Galaxy1-[intestinalData.tsv].tabular
    Untracked:  Galaxy2.txt
    Untracked:  Group.csv
    Untracked:  analysis/Evolution_for_lab.Rmd
    Untracked:  analysis/_site/
    Untracked:  analysis/genomebrowser_for_lab.Rmd
    Untracked:  analysis/tutorial.RNAseq.foradults.xlsx
    Untracked:  bio322.xlsx
    Untracked:  bio322_2022.pptx
    Untracked:  chr15_inversion-v1.0.0.zip
    Untracked:  gene_regulation_bio322_2022.pptx
    Untracked:  gwassim.txt
    Untracked:  intestinalData.tsv
    Untracked:  main_workflow.ga
    Untracked:  markdown_test/
    Untracked:  mouse_intestine_scRNAseq.txt
    Untracked:  oharring-chr15_inversion-9615456/
    Untracked:  science.abg0718_data_s1_to_s8.zip
    Untracked:  science.abg0718_data_s1_to_s8/
    Untracked:  scrna_tenx.ga

Note that any generated files, e.g. HTML, png, CSS, etc., are not included in this status report because it is ok for generated content to have uncommitted changes.

These are the previous versions of the repository in which changes were made to the R Markdown (analysis/2022_genome.function2.Rmd) and HTML (docs/2022_genome.function2.html) files. If you’ve configured a remote Git repository (see ?wflow_git_remote), click on the hyperlinks in the table below to view the files as they were in that past version.

File Version Author Date Message
html 0c87f62 mariesaitou 2022-10-09 Build site.
Rmd 59378af mariesaitou 2022-10-09 wflow_publish("analysis/2022_genome.function2.Rmd")
html 664b5c6 mariesaitou 2022-10-09 Build site.
Rmd b56d9ff mariesaitou 2022-10-09 wflow_publish("analysis/2022_genome.function2.Rmd")

Genome variation and function 2

Goal: Today, we learn about how to analyze genetic variants and its association with phenotype.

  1. Genome wide association study - theory

  2. Genome wide association study - browse real data

Relevant review papers if you want to further learn:

General

Depends on your interest:

Plant

Animal

Fish

1. Lecture part

Prologue - Current topics in genomics

Human genome sequence

Nobel prize 2022

We will learn about:

Methods and significance of functional genomics

Challenges of human genomics

PDF

2. Hands-on tasks

Now, we will investigate real GWAS data at GWAS ATLAS, which concains 4,756 human GWAS across 3,302 traits.

Let’s explore the human GWAS database GWAS ATLAS. In the tutorial, I did not explain everything, so please explore it yourself and get familiarised with it.

Case study 1

Go to “Browse GWAS” in the top, black bar. And search for the trait about eyesight and see the results.

Questions 1

Q1-1. Examine the Manhattan plot. Where do you see the peak? How can we interpret this?

Q1-2. See the left table. How many individuals were investigated?

Q1-3. How many variants were investigated?

Q1-4. See the bottom Manhattan plot with gene annotations. What is the top-associated gene?

Q1-5. (Discuss within groups) - Do some literature search about the top-associated gene and assume how this gene is associated with the trait, “Reason for glasses/contact lenses: For short-sightedness”.

Result 1

Click to display

https://atlas.ctglab.nl/traitDB/3539

A1-1. There are multiple peaks, in the chromosomes 1, 2, 4, 6, 8, 10, 15… The obserbation implies that multiple loci are associated with this trait (The trait is polygenic).

A1-2. 78647 samples (See the left box, “N”)

A1-3. 9223534 SNPs (See the left box, “Nshps”)

A1-4. Reference: T. Alternative: TAGACACTGTCTACCGAAATGTAGACACTGTCTACCGAAATG

A1-5. Discuss within groups.

Case study 2

Go to “Browse GWAS” in the top, black bar. And search for the trait about hair morphology and see the results.

Questions 2

Q2-1. Examine the Manhattan plot. Where do you see the peak? How can we interpret this?

Q2-2. See the left table. How many individuals were investigated?

Q2-3. How many variants were investigated?

Q2-4. See the table under the Manhattan plot with gene annotations. What is the ID of top-associated SNP? (SNP ID: rsXXXXX)

Q2-5. Discuss within the groups - Go to GGV map browser and enter the SNP ID above to see the global distribution of this variant. “A” is the straight hair allele, and “G” is the curly hair allele. What can we estimate from the map?

Result 2

Click to display

https://atlas.ctglab.nl/traitDB/4023

A2-1. There is one big peak at chromosome 2. It is plausible that one genetic factor with very strong effect is associated with this trait.

A2-2. 4878 individuals

A2-3. 560921 SNPs

A2-4. rs260643

A2-5. Discuss within groups.