Read clipping based on quality, position or sequence matching
This tool provides simple, powerful read clipping capabilities that allow you to remove low quality strings of bases, sections of reads, and reads containing user-provided sequences.
There are three options for clipping (quality, position and sequence), which can be used alone or in combination. In addition, you can also specify a clipping representation, which determines exactly how ClipReads applies clips to the reads (soft clips, writing Q0 base quality scores, etc.). Please note that you MUST specify at least one of the three clipping options, and specifying a clipping representation is not sufficient. If you do not specify a clipping option, the program will run but it will not do anything to your reads.
argmax_x{ \sum{i = x + 1}^l (qTrimmingThreshold - qual)
to the end of the read. This is copied from BWA.
Walk through the read from the end (in machine cycle order) to the beginning, calculating the
running sum of qTrimmingThreshold - qual. While we do this, we track the maximum value of this
sum where the delta > 0. After the loop, clipPoint is either -1 (don't do anything) or the
clipping index in the read (from the end).
Any number of BAM files.
A new BAM file containing all of the reads from the input BAMs with the user-specified clipping operation applied to each read.
Number of examined reads 13
Number of clipped reads 13
Percent of clipped reads 100.00
Number of examined bases 988
Number of clipped bases 126
Percent of clipped bases 12.75
Number of quality-score clipped bases 126
Number of range clipped bases 0
Number of sequence clipped bases 0
java -jar GenomeAnalysisTK.jar \
-T ClipReads \
-R reference.fasta \
-I original.bam \
-o clipped.bam \
-XF seqsToClip.fasta \
-X CCCCC \
-CT "1-5,11-15" \
-QT 10
The command line shown above will apply all three options in combination. See the detailed examples below to see how the choice of clipping representation affects the output.
Suppose we are given this read:
314KGAAXX090507:1:19:1420:1123#0 16 chrM 3116 29 76M * * *
TAGGACCCGGGCCCCCCTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
#################4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
If we are clipping reads with -QT 10 and -CR WRITE_NS, we get:
314KGAAXX090507:1:19:1420:1123#0 16 chrM 3116 29 76M * * *
NNNNNNNNNNNNNNNNNTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
#################4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
Whereas with -QT 10 -CR WRITE_Q0S:
314KGAAXX090507:1:19:1420:1123#0 16 chrM 3116 29 76M * * *
TAGGACCCGGGCCCCCCTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
!!!!!!!!!!!!!!!!!4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
Or -QT 10 -CR SOFTCLIP_BASES:
314KGAAXX090507:1:19:1420:1123#0 16 chrM 3133 29 17S59M * * *
TAGGACCCGGGCCCCCCTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
#################4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
These Read Filters are automatically applied to the data by the Engine before processing by ClipReads.
This tool does not apply any downsampling by default.
All tools inherit arguments from the GATK Engine' "CommandLineGATK" argument collection, which can be used to modify various aspects of the tool's function. For example, the -L argument directs the GATK engine to restrict processing to specific genomic intervals; or the -rf argument allows you to apply certain read filters to exclude some of the data from the analysis.
This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.
| Argument name(s) | Default value | Summary | |
|---|---|---|---|
| Optional Outputs | |||
| --out -o |
stdout | Write BAM output here | |
| --outputStatistics -os |
NA | File to output statistics | |
| Optional Parameters | |||
| --clipRepresentation -CR |
WRITE_NS | How should we actually clip the bases? | |
| --clipSequence -X |
NA | Remove sequences within reads matching this sequence | |
| --clipSequencesFile -XF |
NA | Remove sequences within reads matching the sequences in this FASTA file | |
| --cyclesToTrim -CT |
NA | String indicating machine cycles to clip from the reads | |
| --qTrimmingThreshold -QT |
-1 | If provided, the Q-score clipper will be applied | |
Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.
How should we actually clip the bases?
The different values for this argument determines how ClipReads applies clips to the reads. This can range
from writing Ns over the clipped bases to hard clipping away the bases from the BAM.
The --clipRepresentation argument is an enumerated type (ClippingRepresentation), which can have one of the following values:
ClippingRepresentation WRITE_NS
Remove sequences within reads matching this sequence
Clips bases from the reads matching the provided SEQ. Can be provided any number of times on the command line
String[] NA
Remove sequences within reads matching the sequences in this FASTA file
Reads the sequences in the provided FASTA file, and clip any bases that exactly match any of the
sequences in the file.
String NA
String indicating machine cycles to clip from the reads
Clips machine cycles from the read. Accepts a string of ranges of the form start1-end1,start2-end2, etc.
For each start/end pair, removes bases in machine cycles from start to end, inclusive. These are 1-based
values (positions). For example, 1-5,10-12 clips the first 5 bases, and then three bases at cycles 10, 11,
and 12.
String NA
Write BAM output here
The output SAM/BAM file will be written here
GATKSAMFileWriter stdout
File to output statistics
If provided, ClipReads will write summary statistics about the clipping operations applied to the reads in this file.
PrintStream NA
If provided, the Q-score clipper will be applied
If a value > 0 is provided, then the quality score based read clipper will be applied to the reads using this
quality score threshold.
int -1 [ [ -∞ ∞ ] ]